| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219549 |
| Chromosome: | chromosome 5 |
| Location: | 883567 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247500 | (1 of 2) IPR001841//IPR013083//IPR018957 - Zinc finger, RING-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, C3HC4 RING-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTACCAGAGCACGGCAGCAGCTCTGGCA |
| Internal bar code: | ACAAGTGGAGAATGGCGGGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 807 |
| LEAP-Seq percent confirming: | 98.7195 |
| LEAP-Seq n confirming: | 4857 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTGGCGGCGTAGAGATAC |
| Suggested primer 2: | ATGAGTGTATTGCGTGCGAG |