Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.219667 |
Chromosome: | chromosome 11 |
Location: | 1234766 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467699 | SEC1 | Vesicle trafficking protein Sec1; (1 of 1) K15292 - syntaxin-binding protein 1 (STXBP1, MUNC18-1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGGGCGTGCTGGCTGCAGGGGCGAGCAA |
Internal bar code: | CCCGGGAGCGCACGCAGCGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 300 |
LEAP-Seq percent confirming: | 99.3876 |
LEAP-Seq n confirming: | 1623 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGGGCACATCAACTTTTTG |
Suggested primer 2: | TACGGCAATTTGACAAACGA |