Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.219695 |
Chromosome: | chromosome 13 |
Location: | 291400 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g564100 | PTK2 | (1 of 57) 2.7.10.2 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase; Protein tyrosine kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGCATTATATAGATGCTACCGATTAAT |
Internal bar code: | TTTTGAGGGCCATCACTAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 852 |
LEAP-Seq percent confirming: | 98.8785 |
LEAP-Seq n confirming: | 529 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTACCAGCTTCTCTGGGC |
Suggested primer 2: | CATCAGTAGCGGGCCTAGAG |