Insertion junction: LMJ.RY0402.219703_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.219703
Chromosome:chromosome_8
Location:4151928
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense 5'UTR_intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTTAGCACAGCGGAAGAGGGTTGACCTGAG
Internal bar code:TACTCTTGGAATTAACATTTTC

Confirmation - LEAP-Seq

LEAP-Seq distance:645
LEAP-Seq percent confirming:99.32
LEAP-Seq n confirming:9348
LEAP-Seq n nonconfirming:64
LEAP-Seq n unique pos:7

Suggested primers for confirmation by PCR

Suggested primer 1:TGGTGGTCAGAACCAAAACA
Suggested primer 2:TTTTCCTGTGCTTTCCTGCT