| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219717 |
| Chromosome: | chromosome 16 |
| Location: | 2922386 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663950 | ERG3 | Delta-7-sterol-C5(6)-desaturase; (1 of 1) K00227 - lathosterol oxidase (SC5DL, ERG3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACGGTGTTCGGCTGAACTGACGCGCGA |
| Internal bar code: | CCGGGTGGCGCACACCACGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 922 |
| LEAP-Seq percent confirming: | 99.7643 |
| LEAP-Seq n confirming: | 10158 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCATCGAGTAAAGTGGCA |
| Suggested primer 2: | CCAGCGCAAGCTTACCTATC |