| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.219743 |
| Chromosome: | chromosome 10 |
| Location: | 3942817 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448450 | UAPA5,XUV2 | (1 of 2) K06901 - putative MFS transporter, AGZA family, xanthine/uracil permease (pbuG); Xanthine/uracil/vitamin C permease-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCTCAGGTCCGTCCGATCCGAGCGAAGG |
| Internal bar code: | AAGAAAATCTTTTACGTGCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 99.4259 |
| LEAP-Seq n confirming: | 2944 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTCTCGTTTTGCATGCTC |
| Suggested primer 2: | CACGACATTTTGTGGGTCAG |