Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.219819 |
Chromosome: | chromosome 12 |
Location: | 7471050 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g556150 | CGL100 | CAAX amino terminal protease family protein; (1 of 1) PTHR10794:SF52 - CAAX AMINO TERMINAL PROTEASE FAMILY PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCATGTCCGCAATCTTCTTGCCCTTCCA |
Internal bar code: | CCGCCTCGGGCGGGCCCAATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 33 |
LEAP-Seq percent confirming: | 15.3846 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTGATTCTGGAAGGGTGG |
Suggested primer 2: | AGCACGCTCTCACTCTCACA |