| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219849 |
| Chromosome: | chromosome 2 |
| Location: | 286146 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075100 | TPR3 | (1 of 1) PTHR22904//PTHR22904:SF356 - TPR REPEAT CONTAINING PROTEIN // TETRATRICOPEPTIDE REPEAT PROTEIN 1; Tetratricopeptide-repeat protein 3 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAACCCCAATCCTCCTCACCTATTCCA |
| Internal bar code: | CTGGGCCCCGCCACGACGCTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 99.1556 |
| LEAP-Seq n confirming: | 16323 |
| LEAP-Seq n nonconfirming: | 139 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCATTGTAAGCAGCGTCA |
| Suggested primer 2: | CCTGTCCACCGTAGACGAAT |