| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219859 |
| Chromosome: | chromosome 1 |
| Location: | 5906327 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g042050 | MSRB3 | Methionine sulphoxide reductase; (1 of 3) K07305 - peptide-methionine (R)-S-oxide reductase (msrB) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGAGCCGGCCCCGCCGGTGCATGCACAC |
| Internal bar code: | TGGATGGTGAACTCCCTGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 423 |
| LEAP-Seq percent confirming: | 72.6345 |
| LEAP-Seq n confirming: | 2065 |
| LEAP-Seq n nonconfirming: | 778 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATCGCACATTGTGTACC |
| Suggested primer 2: | AACAGGAATACGTTGCGGTC |