| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219915 |
| Chromosome: | scaffold 24 |
| Location: | 27997 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre24.g755297 | MRPS10,uS10m | Mitochondrial ribosomal protein S10; (1 of 4) PF00338 - Ribosomal protein S10p/S20e (Ribosomal_S10) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTCGTGGCCTCCCACCACAGCTGCAGCA |
| Internal bar code: | CGACGCCTGGCTAGAGTTGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 434 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGCCTGCGATGTGTAGAA |
| Suggested primer 2: | TTTGGCTTGGTTTGGGTTAG |