| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.219924 |
| Chromosome: | chromosome 7 |
| Location: | 1934677 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325748 | (1 of 1) 3.5.2.9 - 5-oxoprolinase (ATP-hydrolyzing) / Pyroglutamase (ATP-hydrolyzing) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTGAGGGACGAAGGGGCTGGCAGCAGG |
| Internal bar code: | ATCACCGGGAGGCAACAGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 496 |
| LEAP-Seq percent confirming: | 98.1015 |
| LEAP-Seq n confirming: | 2997 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAAATGCGTGTGTTGGA |
| Suggested primer 2: | CCATGGGATGGTGTGTATCA |