| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.219981 |
| Chromosome: | chromosome 7 |
| Location: | 4643329 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g344350 | TPP1 | Chloroplast thylakoid processing peptidase; (1 of 1) K03100 - signal peptidase I (lepB) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGGAGAAACATGGCCTGTCTGAGAGAT |
| Internal bar code: | ACGTAAGCGGGGGCTGGGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 959 |
| LEAP-Seq percent confirming: | 89.0721 |
| LEAP-Seq n confirming: | 7996 |
| LEAP-Seq n nonconfirming: | 981 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGAAGAGGTTATTTGCCTG |
| Suggested primer 2: | GCATCCAGCTGCACTATTCA |