| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.220016 |
| Chromosome: | chromosome 10 |
| Location: | 2269152 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434400 | PF6 | (1 of 1) K19090 - CRISPR-associated protein Cas5t (cas5t); Flagellar central pair-associated protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTGTACCATCCGGCCCTTCGCAAATCCT |
| Internal bar code: | CGGGTGCAAGTGCATTTAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 525 |
| LEAP-Seq percent confirming: | 99.7062 |
| LEAP-Seq n confirming: | 1018 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGCGTTGCTCTTGTGTA |
| Suggested primer 2: | CATAGGGCTGAGTGATGGGT |