Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.220022 |
Chromosome: | chromosome 16 |
Location: | 3124109 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g665650 | HFLX1,HFLX | Putative chloroplast GTP-bidning protein involved in ribosome hibernation or ribosome biogenesis; (1 of 1) K03665 - GTP-binding protein HflX (hflX) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGTACGTTCAGGGGAGTAGGGGCGTTTG |
Internal bar code: | GCACAGTGACGATCCGGTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1016 |
LEAP-Seq percent confirming: | 99.5862 |
LEAP-Seq n confirming: | 2888 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAGCCGTGTGTCCACAAAA |
Suggested primer 2: | CTTCGCCTACTAATGCCTGC |