Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.220220 |
Chromosome: | chromosome 6 |
Location: | 6497770 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g293100 | (1 of 2) PTHR19957:SF124 - SYNTAXIN-8B-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTGCTGCTGCTGCCGGCTGCTGCCTAC |
Internal bar code: | TCATGTTTGACTCTCGAGGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 518 |
LEAP-Seq percent confirming: | 96.1538 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGGGGTAGATAGGCAACA |
Suggested primer 2: | CAACAATGACACTTCCCGTG |