Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.220363 |
Chromosome: | chromosome 7 |
Location: | 3886874 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g339000 | CrRbcXIIb,RBCX2B | RuBisCO chaperone; (1 of 2) PTHR33791//PTHR33791:SF1 - FAMILY NOT NAMED // CHAPERONIN-LIKE RBCX PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCAATGCTGATGCCTACCCCTGAGACTC |
Internal bar code: | TTGGCTTTATTCGCTGGACGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 458 |
LEAP-Seq percent confirming: | 90.9553 |
LEAP-Seq n confirming: | 8226 |
LEAP-Seq n nonconfirming: | 818 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAACAGAGGCAGCAACAA |
Suggested primer 2: | ATGGATGGTGTCTGCACGTA |