| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.220363 |
| Chromosome: | chromosome 9 |
| Location: | 1758864 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396451 | GOX15 | (1 of 1) IPR011043//IPR014756//IPR015202 - Galactose oxidase/kelch, beta-propeller // Immunoglobulin E-set // Domain of unknown function DUF1929; Glyoxal oxidase 15 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACCACCTGAATTAACCGACCGTGCGGG |
| Internal bar code: | AGGTGCCGAGGGTCAAGCGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 922 |
| LEAP-Seq percent confirming: | 97.7072 |
| LEAP-Seq n confirming: | 11591 |
| LEAP-Seq n nonconfirming: | 272 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGCTTGCCACCCACTTAC |
| Suggested primer 2: | ACAACCCAAATTCCAATCCA |