Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.220367 |
Chromosome: | chromosome 9 |
Location: | 4031095 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393062 | (1 of 55) PTHR23257//PTHR23257:SF394 - SERINE-THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTACACACGCACACACACACACTCACCGC |
Internal bar code: | GGAGGAACGCCAAGGCACGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 848 |
LEAP-Seq percent confirming: | 72.939 |
LEAP-Seq n confirming: | 1159 |
LEAP-Seq n nonconfirming: | 430 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTGTACTCACCATTGTCG |
Suggested primer 2: | CACTCACACACTCACACCCC |