| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.220457 |
| Chromosome: | chromosome 2 |
| Location: | 7346170 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145100 | FAP39 | Flagellar Associated Protein 39; (1 of 1) PF00122//PF00689//PF00690//PF00702//PF12710 - E1-E2 ATPase (E1-E2_ATPase) // Cation transporting ATPase, C-terminus (Cation_ATPase_C) // Cation transporter/ATPase, N-terminus (Cation_ATPase_N) // haloacid dehalogenase-like hydrolase (Hydrolase) // haloacid dehalogenase-like hydrolase (HAD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACCTTCGCAGTGTGCTGACGCCCGACGA |
| Internal bar code: | CGTACGCTTGGACGCTACCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1093 |
| LEAP-Seq percent confirming: | 99.0826 |
| LEAP-Seq n confirming: | 1404 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCTCGTTCCTGTGTATGT |
| Suggested primer 2: | CTGTGGGTGAGGTTGGTCTT |