| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.220469 |
| Chromosome: | chromosome 2 |
| Location: | 1426823 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g083550 | (1 of 1) PF01494//PF05834 - FAD binding domain (FAD_binding_3) // Lycopene cyclase protein (Lycopene_cycl) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAACACAGCCAGGAGTGCTTTGACGCGGC |
| Internal bar code: | CTTGCGATGGAAGCCGGCTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 572 |
| LEAP-Seq percent confirming: | 99.358 |
| LEAP-Seq n confirming: | 22596 |
| LEAP-Seq n nonconfirming: | 146 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTGCATGATGGGAAAGA |
| Suggested primer 2: | CTACACACATGCACCGCAC |