Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.220545 |
Chromosome: | chromosome 17 |
Location: | 5945814 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g740261 | FAP365 | (1 of 96) IPR019734 - Tetratricopeptide repeat; Flagellar Associated Protein 365 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGTGTTGCCCCCGCGCCGGAACACAGC |
Internal bar code: | CAAATCGGATTCGAGCTGGTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1095 |
LEAP-Seq percent confirming: | 99.6837 |
LEAP-Seq n confirming: | 10715 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCATTGCGATAGGGCTTTG |
Suggested primer 2: | GTACCCGTTACTGTTGCCGT |