| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.220673 |
| Chromosome: | chromosome 7 |
| Location: | 44445 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g312300 | LFO1,IsdG | IsdG family heme oxygenase; (1 of 3) 1.14.99.3 - Heme oxygenase (biliverdin-producing) / Heme oxygenase (decyclizing) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCCACCAGTGAACACATTCGGCACGAC |
| Internal bar code: | ATGGCAGCCGTGGTACACTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 867 |
| LEAP-Seq percent confirming: | 99.8146 |
| LEAP-Seq n confirming: | 5385 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCAGAGCCTACCGAAGCAC |
| Suggested primer 2: | CAGCGAACACACCGAGTCTA |