| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.220725 |
| Chromosome: | chromosome 3 |
| Location: | 3755851 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169900 | (1 of 4) IPR023222 - PsbQ-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACCAGTCCCCGCAAACCGCAACGCTTG |
| Internal bar code: | AGTTACGGATATTTATAGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 99.0701 |
| LEAP-Seq n confirming: | 5327 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACAGGGAGGTGAAGGATGA |
| Suggested primer 2: | GAGATTGGGAATGACGAGGA |