| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.220808 |
| Chromosome: | chromosome 9 |
| Location: | 7624681 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414900 | ELG33,ELG41,ELG32 | (1 of 2) PTHR11062//PTHR11062:SF89 - EXOSTOSIN HEPARAN SULFATE GLYCOSYLTRANSFERASE -RELATED // SUBFAMILY NOT NAMED; Exostosin-like glycosyltransferase 41 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTGCAGCTCCTGTGCAGTAGTCGTGAC |
| Internal bar code: | GGATGTACGGAATGAAGGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1012 |
| LEAP-Seq percent confirming: | 99.7299 |
| LEAP-Seq n confirming: | 2954 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGGAACTGTGGGTAGGG |
| Suggested primer 2: | TACCGTCCGACCCATATGTT |