Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.220821 |
Chromosome: | chromosome 17 |
Location: | 4617693 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g733150 | HKR7,HKR78,HKR8,COP12HKR6,COP,COP11 | Histidine kinase rhodopsin 7/8; (1 of 1) PF00072//PF00512//PF01036//PF02518 - Response regulator receiver domain (Response_reg) // His Kinase A (phospho-acceptor) domain (HisKA) // Bacteriorhodopsin-like protein (Bac_rhodopsin) // Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (HATPase_c) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAACTGAGCACACCGTGGATTCGTTGC |
Internal bar code: | TGTAGGTTCGGGTATGGCAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 369 |
LEAP-Seq percent confirming: | 99.3911 |
LEAP-Seq n confirming: | 4897 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATAGCTGAAACCACGCTG |
Suggested primer 2: | CATACCGAGGGTAACACGCT |