| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.220841 |
| Chromosome: | chromosome 3 |
| Location: | 5001140 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180350 | NSG16,CKS1 | Cyclin dependent kinase regulatory subunit; (1 of 1) K02219 - cyclin-dependent kinase regulatory subunit CKS1 (CKS1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAATAAACGGCCTGTGTATCCGGGGTCC |
| Internal bar code: | AACACACCATGATTCTGATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1024 |
| LEAP-Seq percent confirming: | 58.3945 |
| LEAP-Seq n confirming: | 1433 |
| LEAP-Seq n nonconfirming: | 1021 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGCTACTCACGTTCGAC |
| Suggested primer 2: | TCTTGGCGTTGATGTAGCTG |