Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.220884 |
Chromosome: | chromosome 12 |
Location: | 7225464 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g558350 | (1 of 1) PF02609 - Exonuclease VII small subunit (Exonuc_VII_S) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTTCTGACGCCGCCCGGAACTTCTCAAG |
Internal bar code: | TGGCGTGTTGGATTACCGCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 927 |
LEAP-Seq percent confirming: | 98.9656 |
LEAP-Seq n confirming: | 4688 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAACTGGTGTCCCCTGAGT |
Suggested primer 2: | TGGCACTTTGTTTCCTACCC |