Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.220914 |
Chromosome: | chromosome 17 |
Location: | 2249585 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g713600 | SUB13 | (1 of 14) 3.4.21.62 - Subtilisin; Subtilisin-like protease | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCCTGCGCCGCGACAGGGGGCAGGCAG |
Internal bar code: | TGCGGGCGGGCCCTCGGCGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 312 |
LEAP-Seq percent confirming: | 98.213 |
LEAP-Seq n confirming: | 1319 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GATTGAAGAGCTACCGCCTG |
Suggested primer 2: | GGCTAGGAAGACAGTGGCTG |