| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.220946 |
| Chromosome: | chromosome 16 |
| Location: | 5045638 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g684450 | (1 of 1) 2.7.11.1//2.7.11.25//2.7.12.2 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK // Mitogen-activated protein kinase kinase / MKK | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCTTATGGCGCTGCAGCCGTCGACAAG |
| Internal bar code: | CTCACGTCACGCGCTCGTTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 95.239 |
| LEAP-Seq n confirming: | 14923 |
| LEAP-Seq n nonconfirming: | 746 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAGAAGGCACCTGTTTC |
| Suggested primer 2: | GCACGGTTACTAAAGCTCGC |