| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.221151 |
| Chromosome: | chromosome 17 |
| Location: | 5746277 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739150 | CTPA5,TSP5 | (1 of 8) 3.4.21.102 - C-terminal processing peptidase / Tsp protease; putative C-terminal peptidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCAATCCCAAAACAAACCATTGTCAACC |
| Internal bar code: | ACCACCTTTTGTATCTTACATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 482 |
| LEAP-Seq percent confirming: | 97.6654 |
| LEAP-Seq n confirming: | 251 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCCATTAAATCCTCCCGT |
| Suggested primer 2: | CGTCTACCCTACACCTCCCA |