| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.221164 |
| Chromosome: | chromosome 6 |
| Location: | 8043396 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304300 | POA6 | 20S proteasome alpha subunit F; (1 of 1) K02725 - 20S proteasome subunit alpha 6 (PSMA1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTTCTCCCGCATCAACGCCGCCTGTACA |
| Internal bar code: | TGAGGGGGTCCACCCGCTGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 959 |
| LEAP-Seq percent confirming: | 99.0371 |
| LEAP-Seq n confirming: | 1440 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAATGGTGAAGCGTCGAT |
| Suggested primer 2: | CACAATAATCAACATGCCGC |