| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.221292 |
| Chromosome: | chromosome 2 |
| Location: | 6334590 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115150 | (1 of 1) PTHR11266//PTHR11266:SF21 - PEROXISOMAL MEMBRANE PROTEIN 2, PXMP2 MPV17 // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTGACTGCTTAGGAGGCTTGGGTACAA |
| Internal bar code: | ATGGCATAGTCCTCTAACAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 747 |
| LEAP-Seq percent confirming: | 97.7273 |
| LEAP-Seq n confirming: | 473 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGTCATTGACATGCTTGA |
| Suggested primer 2: | TTGTTATGGTGCCCATGCTA |