Insertion junction: LMJ.RY0402.221461_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.221461
Chromosome:chromosome_9
Location:4479735
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g395769 FAP177 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ATGCTGTGTTGCTGTACGCCTCCCCCCCCC
Internal bar code:GCCACAATACCAGACGGGGTGT

Confirmation - LEAP-Seq

LEAP-Seq distance:922
LEAP-Seq percent confirming:99.5285
LEAP-Seq n confirming:2322
LEAP-Seq n nonconfirming:11
LEAP-Seq n unique pos:16

Suggested primers for confirmation by PCR

Suggested primer 1:CAAGGACAAGCTCAAGGAGG
Suggested primer 2:TTTTTCAGGTTGCGGATTTC