| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.221568 |
| Chromosome: | chromosome 4 |
| Location: | 1870004 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217850 | (1 of 3) IPR000104//IPR003439//IPR003593//IPR013525//IPR027417 - Antifreeze protein, type I // ABC transporter-like // AAA+ ATPase domain // ABC-2 type transporter // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATTTGTGACCAGGTATGTGGTTTTTGTA |
| Internal bar code: | TAATCGTCGACGGACCTCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 82.9902 |
| LEAP-Seq n confirming: | 10724 |
| LEAP-Seq n nonconfirming: | 2198 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGTGTTCGTTCCACACCA |
| Suggested primer 2: | GCGTAGGACAGTGTATGCGA |