| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.221610 |
| Chromosome: | chromosome 6 |
| Location: | 5036049 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280350 | (1 of 5) IPR001680//IPR011047//IPR017986//IPR020472 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain // G-protein beta WD-40 repeat | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCAGCGAGGTGACGGTGTTGGTGTGCT |
| Internal bar code: | CTGGGGACACAAAGAAGGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 811 |
| LEAP-Seq percent confirming: | 99.7052 |
| LEAP-Seq n confirming: | 31114 |
| LEAP-Seq n nonconfirming: | 92 |
| LEAP-Seq n unique pos: | 125 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGTCACAATGACCTTTTT |
| Suggested primer 2: | GTGCATGCGTATGGTTTACG |