Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.221746 |
Chromosome: | chromosome 5 |
Location: | 3268176 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g240225 | (1 of 1) IPR008754//IPR024079 - Peptidase M43, pregnancy-associated plasma-A // Metallopeptidase, catalytic domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTGGCAGGGGGGATTAGGTCATTCATTC |
Internal bar code: | CAATGAGCGGCGTTGGATATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 553 |
LEAP-Seq percent confirming: | 97.5992 |
LEAP-Seq n confirming: | 935 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCATCCACATACTGAACCC |
Suggested primer 2: | CTCGCTTCGTCTCTCTTGCT |