Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.221839 |
Chromosome: | chromosome 17 |
Location: | 1489917 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g707050 | UAF5,SPL12 | U2 snRNP auxiliary factor associated protein; (1 of 1) K13093 - HIV Tat-specific factor 1 (HTATSF1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTATGGAAACCCTCTTGCTTTGACTTTC |
Internal bar code: | ATTCTTACCCTACGCGCGTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 632 |
LEAP-Seq percent confirming: | 99.6586 |
LEAP-Seq n confirming: | 3211 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTACCGTGACAACTGGCTGA |
Suggested primer 2: | ATTCTCACAACGCTGCCTCT |