| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.221886 |
| Chromosome: | chromosome 6 |
| Location: | 4884068 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279050 | (1 of 7) PTHR11584:SF381 - PROTEIN PQN-80, ISOFORM B | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTTTCAGAATGTGCGGATCGTGCACGCA |
| Internal bar code: | CTACATTCGAGTGTCGGTCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 200 |
| LEAP-Seq percent confirming: | 97.2826 |
| LEAP-Seq n confirming: | 537 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGTCAGCGAACCACTCC |
| Suggested primer 2: | ATCTTTAACTTTCGGCCGGT |