| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.221989 |
| Chromosome: | chromosome 3 |
| Location: | 8784275 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205697 | FAP350 | (1 of 2) PTHR23155//PTHR23155:SF401 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // LEUCINE-RICH REPEAT-CONTAINING PROTEIN; Leucine-Rich-Repeat Coiled-Coil Flagellar Associated Protein 350 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCATTGGGGATGCTAAAATCCCCCTTA |
| Internal bar code: | GAACTCGTGAAATATGTGTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 98.2206 |
| LEAP-Seq n confirming: | 276 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGAAGGGTGAAAGCAGC |
| Suggested primer 2: | TGCACTTCTCTGCACCAATC |