| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.221997 |
| Chromosome: | chromosome 14 |
| Location: | 1680516 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g619300 | CYN16 | Cyclophilin 16; (1 of 60) 5.2.1.8 - Peptidylprolyl isomerase / Rotamase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCACGGCTGGCGCTGCAACGCTGGCTCC |
| Internal bar code: | GCTGGAGATCTTGGCATGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1019 |
| LEAP-Seq percent confirming: | 99.7372 |
| LEAP-Seq n confirming: | 10246 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGCCATTGTTCCTTGAAT |
| Suggested primer 2: | ACGCCTTTTGAAATTTGTGG |