| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.222091 |
| Chromosome: | chromosome 9 |
| Location: | 5231486 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399476 | (1 of 1) IPR003034//IPR003593//IPR003959//IPR027417 - SAP domain // AAA+ ATPase domain // ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTGCGTGGTCAGTCAATGCAGACTACA |
| Internal bar code: | GCTCAGCGTCATGCGGGGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 888 |
| LEAP-Seq percent confirming: | 99.1468 |
| LEAP-Seq n confirming: | 16618 |
| LEAP-Seq n nonconfirming: | 143 |
| LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGATTTCGCTCTGAAGGC |
| Suggested primer 2: | CGGAGACTCCACAATTGGAT |