Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.222099 |
Chromosome: | chromosome 10 |
Location: | 582956 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g421650 | paralog of LCI36; (1 of 4) K15382 - solute carrier family 50 (sugar transporter) (SLC50A, SWEET) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCCGTGTACGGCGCACGTGACGACAGCG |
Internal bar code: | CCGTCCCTTTTTGAACCTTTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 319 |
LEAP-Seq percent confirming: | 95.1354 |
LEAP-Seq n confirming: | 3618 |
LEAP-Seq n nonconfirming: | 185 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGTTATGAATGTGGCACG |
Suggested primer 2: | GTGACGCAACAATGCATACC |