| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.222229 |
| Chromosome: | chromosome 9 |
| Location: | 6362140 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406950 | (1 of 5) IPR000104//IPR016024 - Antifreeze protein, type I // Armadillo-type fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGGGTGGGGCCATCACGCTGTCCAAGCG |
| Internal bar code: | GGGCTGTATGACCGGCCTGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 683 |
| LEAP-Seq percent confirming: | 87.8196 |
| LEAP-Seq n confirming: | 21435 |
| LEAP-Seq n nonconfirming: | 2973 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGTACACGCAGGCACAG |
| Suggested primer 2: | GGACTGCTTCTGCTTCTGCT |