Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.222230 |
Chromosome: | chromosome 11 |
Location: | 1584534 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467759 | PIC1,PIC1-2 | (1 of 2) PTHR34548:SF2 - PROTEIN TIC 21, CHLOROPLASTIC; Similar to AtTic21/PIC1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTCCAGGACACGCGTGTCAAACCCCCGT |
Internal bar code: | GATCTACCGGGACCGCACATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 302 |
LEAP-Seq percent confirming: | 99.6583 |
LEAP-Seq n confirming: | 4958 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGTGGGGGATAGCACTGT |
Suggested primer 2: | TCGTTGCCACTCAAGTTACG |