| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.222250 |
| Chromosome: | chromosome 11 |
| Location: | 2445045 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475350 | (1 of 1) PF05093 - Cytokine-induced anti-apoptosis inhibitor 1, Fe-S biogenesis (CIAPIN1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAAATAAACAGGGCCAACCTGCGAGCCT |
| Internal bar code: | GCGACATCAAGGGCCACTGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 846 |
| LEAP-Seq percent confirming: | 99.6605 |
| LEAP-Seq n confirming: | 20255 |
| LEAP-Seq n nonconfirming: | 69 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAAACCCTGACACCCACT |
| Suggested primer 2: | GCTTTCATCGGTAGAGCTGG |