| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.222311 |
| Chromosome: | chromosome 15 |
| Location: | 1090789 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g638304 | NCL30,OPR74 | Nuclear Control of chloroplast Like 30 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAGTTGGATGGGGCTTGGGCTCCAATT |
| Internal bar code: | TAGAAACACCTGCTCAAGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 771 |
| LEAP-Seq percent confirming: | 88.8609 |
| LEAP-Seq n confirming: | 5991 |
| LEAP-Seq n nonconfirming: | 751 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAAGACGCATCCTCGTTGT |
| Suggested primer 2: | TGTAGGCAGTGAGCAGGATG |