| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.222420 |
| Chromosome: | chromosome 2 |
| Location: | 7569469 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143800 | SRH3 | SNF2-related DNA/RNA helicase; (1 of 8) IPR000330//IPR001650//IPR014001//IPR027417 - SNF2-related, N-terminal domain // Helicase, C-terminal // Helicase superfamily 1/2, ATP-binding domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGGGGAGCTGGGGATAGGGGGTGGGGA |
| Internal bar code: | GCTACGATCGCTTGAGAACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 97.104 |
| LEAP-Seq n confirming: | 1643 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGTTTAGTTTGGGCTGG |
| Suggested primer 2: | GTAAGGAACTGCAAACCCCA |