| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.222482 |
| Chromosome: | chromosome 17 |
| Location: | 2537282 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716451 | (1 of 1) 1.14.11.13 - Gibberellin 2-beta-dioxygenase / Gibberellin 2-beta-hydroxylase; Similar to plant Gibberellin 2-beta-dioxygenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTGCCGGAGGTCAGGCTGCAGGCTTGC |
| Internal bar code: | GGGTACGCGCGCCAGCCGCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 82.0809 |
| LEAP-Seq n confirming: | 426 |
| LEAP-Seq n nonconfirming: | 93 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTGTGGTCGTGTTATCG |
| Suggested primer 2: | GAAACGCGCTATCTACCTGC |