| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.222550 |
| Chromosome: | chromosome 13 |
| Location: | 5194376 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607950 | SELK,SELENOK,SELK1 | (1 of 1) PTHR16875:SF0 - SELENOPROTEIN K; Selenoprotein K | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGCCGCGTTGCAGCGCGCAAACTCTTG |
| Internal bar code: | AAACGGAGACCTAGGATAGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1032 |
| LEAP-Seq percent confirming: | 99.4325 |
| LEAP-Seq n confirming: | 1752 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCCATTGCTTCCATCTGC |
| Suggested primer 2: | ATGGCTTTCGTTTATGACGG |