| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.222671 |
| Chromosome: | chromosome 16 |
| Location: | 1820093 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g655400 | (1 of 1) K17985 - activating molecule in BECN1-regulated autophagy protein 1 (AMBRA1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGCCCCTTCTGCCCCCCGCCCCGTGTG |
| Internal bar code: | GGGGAGTAACTCAGCGGCCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 720 |
| LEAP-Seq percent confirming: | 96.5333 |
| LEAP-Seq n confirming: | 724 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAATCTGCTTACGGGCGTC |
| Suggested primer 2: | TTACAAGGTACAGCCCCCAG |